Stem-loop sequence bta-mir-2439

AccessionMI0011492 (change log)
DescriptionBos taurus miR-2439 stem-loop
Literature search

1 open access papers mention bta-mir-2439
(1 sentences)

Stem-loop
      uug      -  g     g  ga    c  au   u 
5' guc   ccgucu cu gccug cu  ugau uc  acc u
   |||   |||||| || ||||| ||  |||| ||  ||| g
3' cag   ggcaga gg uggac ga  acua ag  ugg a
      cca      c  a     a  ag    u  --   u 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 112696083-112696160 [-]
sense
ENSBTAT00000003407 ; MKL1-201; intron 1
Database links

Mature sequence bta-miR-2439-5p

Accession MIMAT0012013
Previous IDsbta-miR-2439*
Sequence

12 - 

ucuggccuggcugaugaucuca

 - 33

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2439-3p

Accession MIMAT0012014
Previous IDsbta-miR-2439
Sequence

48 - 

uaucagaagacagguaggcaga

 - 69

Get sequence
Deep sequencing44 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).