Stem-loop sequence bta-mir-2425

AccessionMI0011475 (change log)
DescriptionBos taurus miR-2425 stem-loop
Literature search

3 open access papers mention bta-mir-2425
(92 sentences)

Stem-loop
       auu      cc      c  a  c      ua  cu 
5' aggc   gaggga  agggca gg uc augaac  gg  a
   ||||   ||||||  |||||| || || ||||||  ||  c
3' uccg   cucccu  ucccgu cc ag ugcuug  cc  u
       -ac      cc      c  -  a      ca  au 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 30303905-30303985 [+]
sense
ENSBTAT00000006377 ; NCKAP5L-201; intron 1
ENSBTAT00000064875 ; NCKAP5L-202; intron 1
Database links

Mature sequence bta-miR-2425-5p

Accession MIMAT0011994
Previous IDsbta-miR-2425
Sequence

14 - 

ccagggcacggauccaugaacu

 - 35

Get sequence
Deep sequencing82 reads, 31 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-2425-3p

Accession MIMAT0011995
Previous IDsbta-miR-2425*
Sequence

51 - 

uucguagacccugcccuccu

 - 70

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).