Stem-loop sequence bta-mir-2422

AccessionMI0011470 (change log)
DescriptionBos taurus miR-2422 stem-loop
Literature search

1 open access papers mention bta-mir-2422
(1 sentences)

Stem-loop
   uc           -  a  -u      acg  cag 
5'   cuugaggggac ug gg  gcggag   ca   a
     ||||||||||| || ||  ||||||   ||    
3'   ggacuccucug ac cc  cgccuc   gu   u
   -a           c  -  uu      cua  uac 
Get sequence
Deep sequencing
452 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 93932865-93932932 [+]
sense
ENSBTAT00000008207 ; FLNC-201; 3'UTR (exon 10)
Database links

Mature sequence bta-miR-2422

Accession MIMAT0011989
Sequence

4 - 

uugaggggacugaggugcggag

 - 25

Get sequence
Deep sequencing429 reads, 36 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).