Stem-loop sequence bta-mir-2419

AccessionMI0011467 (change log)
DescriptionBos taurus miR-2419 stem-loop
Literature search

1 open access papers mention bta-mir-2419
(2 sentences)

Stem-loop
               c  caa                 au 
5' ccucuaugaucg au   cacucgucuguucuuaa  a
   |||||||||||| ||   |||||||||||||||||   
3' ggagauacuagc ua   gugggcggacaagaguu  a
               a  auc                 ac 
Get sequence
Deep sequencing
3697 reads, 60.5 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 66580841-66580916 [-]
intergenic
Database links

Mature sequence bta-miR-2419-5p

Accession MIMAT0011985
Previous IDsbta-miR-2419
Sequence

9 - 

aucgcaucaacacucgucuguu

 - 30

Get sequence
Deep sequencing3631 reads, 76 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-2419-3p

Accession MIMAT0011986
Previous IDsbta-miR-2419*
Sequence

49 - 

caggcgggugcuaauacgauca

 - 70

Get sequence
Deep sequencing66 reads, 19 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).