Stem-loop sequence bta-mir-2413

AccessionMI0011458 (change log)
DescriptionBos taurus miR-2413 stem-loop
Literature search

2 open access papers mention bta-mir-2413
(2 sentences)

Stem-loop
       c cccu   c  uc      -a     c   u   a 
5' uccu c    cuc cc  cagucc  cuggg ucc ggc g
   |||| |    ||| ||  ||||||  ||||| ||| ||| g
3' agga g    gag gg  gucagg  gaccc agg ucg a
       c -acu   u  -c      gg     -   c   a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 33913672-33913750 [-]
intergenic
Database links

Mature sequence bta-miR-2413

Accession MIMAT0011975
Sequence

46 - 

ucggacccagggggacugcggu

 - 67

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).