Stem-loop sequence bta-mir-1584

AccessionMI0011454 (change log)
DescriptionBos taurus miR-1584 stem-loop
Literature search

3 open access papers mention bta-mir-1584
(5 sentences)

Stem-loop
     c     c       -   g cu         g a 
5' gg ugagc guugggg cug g  gggggcagg a u
   || ||||| ||||||| ||| |  ||||||||| |  
3' uc acucg cgacucc gac c  cucucgucu u c
     a     c       a   g cu         g u 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr3: 9944706-9944778 [+]
sense
ENSBTAT00000002674 ; TAGLN2-201; intron 1
Database links

Mature sequence bta-miR-1584-5p

Accession MIMAT0011969
Previous IDsbta-miR-1584
Sequence

11 - 

uuggggcugggcugggggca

 - 30

Get sequence
Deep sequencing13 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-1584-3p

Accession MIMAT0011970
Previous IDsbta-miR-1584*
Sequence

45 - 

cucucuccgcagaccucagccg

 - 66

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).