Stem-loop sequence bta-mir-2284q

AccessionMI0011442 (change log)
DescriptionBos taurus miR-2284q stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284q
(32 sentences)

Stem-loop
       a       c       a  uu      u 
5' ggcc aaaaguu guucgga uu  ccauca a
   |||| ||||||| ||||||| ||  ||||||  
3' ccgg uuuuuaa caagccu aa  gguggu a
       g       a       -  uc      g 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr27: 35183619-35183683 [-]
intergenic
Database links

Mature sequence bta-miR-2284q

Accession MIMAT0011957
Sequence

1 - 

ggccaaaaaguucguucgga

 - 20

Get sequence
Deep sequencing63 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).