Stem-loop sequence bta-mir-2285c

AccessionMI0011437 (change log)
DescriptionBos taurus miR-2285c stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2285c
(17 sentences)

Stem-loop
          u   c   g -ag       a   g 
5' gccgaaa guu guu a   uuuuucc ugg g
   ||||||| ||| ||| |   ||||||| |||  
3' cgguuuu caa caa u   aagaagg acu u
          u   a   g cca       c   g 
Get sequence
Deep sequencing
4458 reads, 15.3 reads per million, 72 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr26: 47382359-47382423 [-]
antisense
ENSBTAT00000032730 ; DOCK1-201; intron 31
Database links

Mature sequence bta-miR-2285c

Accession MIMAT0011950
Sequence

44 - 

aaaccugaacaaacuuuuuggc

 - 65

Get sequence
Deep sequencing4458 reads, 72 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).