Stem-loop sequence bta-mir-2284c

AccessionMI0011415 (change log)
DescriptionBos taurus miR-2284c stem-loop
Gene family MIPF0000747; mir-2284
Literature search

15 open access papers mention bta-mir-2284c
(34 sentences)

Stem-loop
     ua     ac  a    u      u       c  cac 
5' au  gguug  ca aaag ucguuu gguuuuu ug   a
   ||  |||||  || |||| |||||| ||||||| ||    
3' ua  cuaac  gu uuuc agcaaa ccaaaaa au   a
     gc     ca  c    c      c       u  ucu 
Get sequence
Deep sequencing
6322 reads, 25.4 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 35734835-35734914 [+]
intergenic
Database links

Mature sequence bta-miR-2284c

Accession MIMAT0011926
Sequence

13 - 

aaaaaguucguuuugguuuu

 - 32

Get sequence
Deep sequencing6302 reads, 64 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).