Stem-loop sequence bta-mir-2376

AccessionMI0011411 (change log)
DescriptionBos taurus miR-2376 stem-loop
Literature search

2 open access papers mention bta-mir-2376
(3 sentences)

Stem-loop
   --   -      g           a -c    a u 
5'   ggg gcuugg agggucucaga g  agga c u
     ||| |||||| ||||||||||| |  |||| |  
3'   cuc cggauc uucuagagucu c  uccu g u
   cc   g      g           c uu    c u 
Get sequence
Deep sequencing
254 reads, 1.75 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 7447155-7447222 [-]
sense
ENSBTAT00000022386 ; TAPBP-201; intron 3
Database links

Mature sequence bta-miR-2376

Accession MIMAT0011922
Sequence

43 - 

ccucugagaucuugcuaggcgcu

 - 65

Get sequence
Deep sequencing253 reads, 57 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).