Stem-loop sequence bta-mir-2284k

AccessionMI0011400 (change log)
DescriptionBos taurus miR-2284k stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284k
(32 sentences)

Stem-loop
     u  a       a    ggucg       cug  aca 
5' ag ug ccagaaa guuc     gguuuuu   ca   u
   || || ||||||| ||||     |||||||   ||    
3' uc ac gguuuuu caag     ccaaaaa   gu   c
     c  c       -    -aaaa       --a  aau 
Get sequence
Deep sequencing
62114 reads, 373 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 70380569-70380642 [-]
intergenic
Database links

Mature sequence bta-miR-2284k

Accession MIMAT0011907
Sequence

10 - 

gaaaaguucggucggguuuuu

 - 30

Get sequence
Deep sequencing62095 reads, 77 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).