Stem-loop sequence bta-mir-2284f

AccessionMI0011398 (change log)
DescriptionBos taurus miR-2284f stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284f
(32 sentences)

Stem-loop
              c      au       g a 
5' gccaaaaaguu guucgg  uuuuccg a g
   ||||||||||| ||||||  ||||||| | c
3' cgguuuuucaa caagcc  aaaaggu u u
              a      -c       g g 
Get sequence
Deep sequencing
10059 reads, 34.2 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 57993852-57993913 [+]
sense
ENSBTAT00000008703 ; SLC24A4-201; intron 10
Database links

Mature sequence bta-miR-2284f

Accession MIMAT0011905
Sequence

6 - 

aaaguucguucggauuuuuc

 - 25

Get sequence
Deep sequencing7691 reads, 67 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).