Stem-loop sequence bta-mir-2366

AccessionMI0011397 (change log)
DescriptionBos taurus miR-2366 stem-loop
Gene family MIPF0001403; mir-2366
Literature search

2 open access papers mention bta-mir-2366
(2 sentences)

Stem-loop
       g  gu     ug    a c     aaagag 
5' cccc gg  ccucu  ucug g cccag      g
   |||| ||  |||||  |||| | |||||      a
3' gggg uc  ggaga  agac c ggguc      g
       g  ug     --    a u     gugaga 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 56064696-56064764 [+]
sense
ENSBTAT00000038632 ; MAP1A-201; intron 2
Database links

Mature sequence bta-miR-2366

Accession MIMAT0011904
Sequence

45 - 

ugggucacagaagagggucugg

 - 66

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).