Stem-loop sequence bta-mir-2363-1

AccessionMI0011393 (change log)
DescriptionBos taurus miR-2363-1 stem-loop
Gene family MIPF0000806; mir-2363
Literature search

3 open access papers mention bta-mir-2363-1
(3 sentences)

Stem-loop
                                  ua  g 
5' ucuaagaaauauuccuugaccaaguugaaau  au a
   |||||||||||||||||||||||||||||||  ||  
3' agauucuuuauaaggaacugguucaacuuug  ua g
                                  ga  a 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 21233983-21234056 [+]
sense
ENSBTAT00000011991 ; FANCI-201; intron 10
antisense
ENSBTAT00000047900 ; RLBP1-201; intron 5
Clustered miRNAs
< 10kb from bta-mir-2363-1
bta-mir-2363-1chr21: 21233983-21234056 [+]
bta-mir-2363-2chr21: 21233984-21234055 [-]
Database links

Mature sequence bta-miR-2363

Accession MIMAT0011901
Sequence

47 - 

ucaacuuggucaaggaauauuu

 - 68

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).