Stem-loop sequence bta-mir-2284u

AccessionMI0011387 (change log)
DescriptionBos taurus miR-2284u stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284u
(32 sentences)

Stem-loop
         ----u  u     -c    c   u  gcuag   c 
5' gccaac     gc aggag  ccga acg ac     ggg u
   ||||||     || |||||  |||| ||| ||     |||  
3' cgguug     cg ucuuu  ggcu ugc ug     ccc g
         uaacc  -     uu    -   u  -aaaa   g 
Get sequence
Deep sequencing
5334 reads, 17.5 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 131328372-131328447 [+]
antisense
ENSBTAT00000021869 ; ZBTB40-201; intron 14
Database links

Mature sequence bta-miR-2284u

Accession MIMAT0011895
Sequence

43 - 

aaaaguucguucgguuuuucu

 - 63

Get sequence
Deep sequencing5334 reads, 63 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).