Stem-loop sequence bta-mir-2339

AccessionMI0011366 (change log)
DescriptionBos taurus miR-2339 stem-loop
Literature search

3 open access papers mention bta-mir-2339
(6 sentences)

Stem-loop
       cu      c     --c     cu     cugc 
5' aggu  gggcuc ugcug   ccagu  gaggu    a
   ||||  |||||| |||||   |||||  |||||    c
3' uuca  cucgag acgau   gguca  cuccg    u
       cc      -     cca     --     uuuc 
Get sequence
Deep sequencing
279 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 32129951-32130022 [-]
sense
ENSBTAT00000029249 ; ELAC2-201; intron 10
Database links

Mature sequence bta-miR-2339

Accession MIMAT0011873
Sequence

46 - 

ucacuggaccuagcagagcu

 - 65

Get sequence
Deep sequencing279 reads, 63 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).