Stem-loop sequence bta-mir-199c

AccessionMI0011364 (change log)
DescriptionBos taurus miR-199c stem-loop
Literature search

6 open access papers mention bta-mir-199c
(19 sentences)

Stem-loop
       gu  uucuua        uu      ----     a 
5' auca  gg      cggugugu  gcuacu    auuga a
   ||||  ||      ||||||||  ||||||    |||||  
3' uagu  uc      guuacacg  ugauga    ugacu c
       gu  --uucg        uc      caug     g 
Get sequence
Deep sequencing
326498 reads, 2.8e+03 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 26881087-26881162 [+]
sense
ENSBTAT00000001625 ; NUP88-201; intron 2
Database links

Mature sequence bta-miR-199c

Accession MIMAT0011871
Sequence

46 - 

uacaguagucugcacauugg

 - 65

Get sequence
Deep sequencing326498 reads, 68 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).