Stem-loop sequence bta-mir-2336

AccessionMI0011362 (change log)
DescriptionBos taurus miR-2336 stem-loop
Stem-loop
                       c  a     u      c 
5' aaauagaaagcauuucaaag ua gguua gggugg a
   |||||||||||||||||||| || ||||| ||||||  
3' uuugucuuucgugaaguuuc au ccaau ccuauu a
                       a  g     c      u 
Get sequence
Deep sequencing
1901 reads, 2.94 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 22956198-22956273 [+]
intergenic
Database links

Mature sequence bta-miR-2336

Accession MIMAT0011869
Sequence

47 - 

cuaaccguaacuuugaagugcu

 - 68

Get sequence
Deep sequencing1901 reads, 68 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).