Stem-loop sequence bta-mir-2332

AccessionMI0011358 (change log)
DescriptionBos taurus miR-2332 stem-loop
Gene family MIPF0002022; mir-2332
Literature search

2 open access papers mention bta-mir-2332
(3 sentences)

Stem-loop
   cauagca -      c   acgu      cu   u 
5'        g cuccag acc    gacuga  gcc g
          | |||||| |||    ||||||  |||  
3'        c gagguu ugg    uuggcu  cgg g
   -gugaaa a      c   -aau      cu   a 
Get sequence
Deep sequencing
304 reads, 3.28 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 18689292-18689360 [+]
sense
ENSBTAT00000059672 ; SNORA54-201; exon 1
ENSBTAT00000020740 ; UTP6-201; intron 8
Database links

Mature sequence bta-miR-2332

Accession MIMAT0011865
Sequence

44 - 

cgguuuaaggucuuggagacaaag

 - 67

Get sequence
Deep sequencing289 reads, 61 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).