Stem-loop sequence bta-mir-2284g

AccessionMI0011344 (change log)
DescriptionBos taurus miR-2284g stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284g
(32 sentences)

Stem-loop
   u  a      c      ucguu   --c           
5'  gg uugguc aaaagu     cgg   uuuuucugua 
    || |||||| ||||||     |||   ||||||||| a
3'  cc aaccgg uuuuca     gcc   aaaaagguac 
   a  c      a      ----c   uaa           
Get sequence
Deep sequencing
5528 reads, 16.4 reads per million, 67 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr17: 12953898-12953968 [+]
antisense
ENSBTAT00000003668 ; SMAD1-201; intron 4
Database links

Mature sequence bta-miR-2284g

Accession MIMAT0011847
Sequence

12 - 

aaaaguucguucggcuuuuu

 - 31

Get sequence
Deep sequencing5526 reads, 67 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).