Stem-loop sequence bta-mir-2320

AccessionMI0011342 (change log)
DescriptionBos taurus miR-2320 stem-loop
Gene family MIPF0001253; mir-2320
Literature search

3 open access papers mention bta-mir-2320
(8 sentences)

Stem-loop
   u u     ug        u   gc        --g  a 
5'  g cccca  gcacaggg cca  ugucggcc   ug u
    | |||||  |||||||| |||  ||||||||   || a
3'  c ggggu  uguguccc ggu  guagcugg   gc c
   g -     uu        u   -a        gua  c 
Get sequence
Deep sequencing
599 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 50680566-50680640 [+]
sense
ENSBTAT00000034094 ; CEP104-201; intron 1
Database links

Mature sequence bta-miR-2320-5p

Accession MIMAT0011844
Previous IDsbta-miR-2320
Sequence

9 - 

uggcacaggguccagcugucggc

 - 31

Get sequence
Deep sequencing487 reads, 63 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2320-3p

Accession MIMAT0011845
Previous IDsbta-miR-2320*
Sequence

48 - 

ucgaugauggucccuguguuuu

 - 69

Get sequence
Deep sequencing111 reads, 52 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).