Stem-loop sequence bta-mir-1343

AccessionMI0011338 (change log)
DescriptionBos taurus miR-1343 stem-loop
Gene family MIPF0001206; mir-1343
Literature search

2 open access papers mention bta-mir-1343
(5 sentences)

Stem-loop
       u   u  u    a    c       -c     ucu 
5' ggcu cgg gc gggg gcgg ccccggg  gggcc   g
   |||| ||| || |||| |||| |||||||  |||||    
3' ccgg gcc cg ucuc cgcc ggggucc  cccgg   c
       -   u  c    a    c       uc     ucu 
Get sequence
Deep sequencing
1660 reads, 7.14 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 66591432-66591509 [+]
sense
ENSBTAT00000024307 ; PDHX-201; intron 2
Database links

Mature sequence bta-miR-1343-5p

Accession MIMAT0011839
Previous IDsbta-miR-1343
Sequence

12 - 

uggggagcggcccccgggcggg

 - 33

Get sequence
Deep sequencing15 reads, 12 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-1343-3p

Accession MIMAT0011840
Previous IDsbta-miR-1343*
Sequence

49 - 

cuccuggggcccgcacucuc

 - 68

Get sequence
Deep sequencing1629 reads, 69 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).