Stem-loop sequence bta-mir-2284d

AccessionMI0011335 (change log)
DescriptionBos taurus miR-2284d stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284d
(32 sentences)

Stem-loop
   u a    ac     a   c   a          uc  g 
5'  g guug  caaaa guu guu ggguuuuucu  aa c
    | ||||  ||||| ||| ||| ||||||||||  ||  
3'  c caac  guuuu caa caa cucaaaaggg  uu u
   a c    cu     c   a   g          ca  c 
Get sequence
Deep sequencing
12215 reads, 41.4 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 43745466-43745543 [-]
sense
ENSBTAT00000002578 ; HSPC321-201; intron 2
Database links

Mature sequence bta-miR-2284d

Accession MIMAT0011836
Sequence

11 - 

aaaaaguucguuaggguuuuuc

 - 32

Get sequence
Deep sequencing12208 reads, 69 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).