Stem-loop sequence bta-mir-2284l

AccessionMI0011325 (change log)
DescriptionBos taurus miR-2284l stem-loop
Gene family MIPF0000747; mir-2284
Literature search

13 open access papers mention bta-mir-2284l
(32 sentences)

Stem-loop
   u   c        g   c          cccc     
5'  ggc aaaaaguu guu ggguuuuuuc    caua 
    ||| |||||||| ||| ||||||||||    ||| c
3'  ccg uuuuucaa cga cucaaaaagg    guag 
   a   a        a   a          cauu     
Get sequence
Deep sequencing
5450 reads, 19.1 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 39256496-39256568 [+]
antisense
ENSBTAT00000002684 ; STAU2-201; intron 5
Database links

Mature sequence bta-miR-2284l

Accession MIMAT0011824
Sequence

7 - 

aaaaguugguucggguuuuu

 - 26

Get sequence
Deep sequencing5416 reads, 67 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).