Stem-loop sequence bta-mir-2309

AccessionMI0011322 (change log)
DescriptionBos taurus miR-2309 stem-loop
Literature search

1 open access papers mention bta-mir-2309
(1 sentences)

Stem-loop
       -      u      g g    a    -    g g 
5' aggc agcagg gugagg u gugg cggc aggg u g
   |||| |||||| |||||| | |||| |||| |||| | g
3' ucug ucgucc cacucc g cacc gccg uccu g c
       g      -      g a    -    g    g a 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 2115108-2115182 [+]
sense
ENSBTAT00000015828 ; PLEC-201; intron 14
Database links

Mature sequence bta-miR-2309

Accession MIMAT0011821
Sequence

11 - 

ugugagggugguggacggcaggg

 - 33

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).