Stem-loop sequence bta-mir-2308

AccessionMI0011321 (change log)
DescriptionBos taurus miR-2308 stem-loop
Literature search

1 open access papers mention bta-mir-2308
(1 sentences)

Stem-loop
      -agu -       -a       c  gugc   c 
5' cuc    c cucugcu  aagccca cu    ucc g
   |||    | |||||||  ||||||| ||    ||| c
3' gag    g gagacga  uucgggu ga    agg c
      gaau a       cg       u  ---a   u 
Get sequence
Deep sequencing
121 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr14: 1612166-1612234 [+]
sense
ENSBTAT00000037363 ; ARHGAP39-201; intron 1
Database links

Mature sequence bta-miR-2308

Accession MIMAT0011820
Sequence

44 - 

uugggcuugcagcagagaguaa

 - 65

Get sequence
Deep sequencing119 reads, 33 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).