Stem-loop sequence bta-mir-2306

AccessionMI0011319 (change log)
DescriptionBos taurus miR-2306 stem-loop
Literature search

1 open access papers mention bta-mir-2306
(1 sentences)

Stem-loop
      ca  uuu   a ca         u   u    -u  a 
5' ccu  ca   cug g  uccuggaug gug gccu  cu g
   |||  ||   ||| |  ||||||||| ||| ||||  ||  
3' gga  gu   gac c  aggaucuac cgu cgga  ga a
      ag  -cu   - ac         c   c    cc  a 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 55593330-55593408 [+]
intergenic
Database links

Mature sequence bta-miR-2306

Accession MIMAT0011818
Sequence

46 - 

caggccugcccaucuaggacac

 - 67

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).