Stem-loop sequence bta-mir-2305

AccessionMI0011318 (change log)
DescriptionBos taurus miR-2305 stem-loop
Literature search

3 open access papers mention bta-mir-2305
(14 sentences)

Stem-loop
   ---  uc g     -    gg -----       g g 
5'    gc  g gggug gcgg  a     ggggggc g g
      ||  | ||||| ||||  |     ||||||| |  
3'    cg  u ucuac cguc  u     ucccuug c c
   cga  -u g     a    uu uuggg       g a 
Get sequence
Deep sequencing
20 reads, 50 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 39974755-39974820 [+]
sense
ENSBTAT00000056271 ; RIN2-201; intron 5
Database links

Mature sequence bta-miR-2305

Accession MIMAT0011817
Sequence

4 - 

cggggguggcggggaggggg

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).