Stem-loop sequence bta-mir-2285d

AccessionMI0011316 (change log)
DescriptionBos taurus miR-2285d stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285d
(15 sentences)

Stem-loop
   u          g     -  u --a    uccaua 
5'  uggccaaaag uucgu ca g   uuuc      a
    |||||||||| ||||| || |   ||||      a
3'  accgguuuuu aagca gu c   aaag      a
   a          a     a  c aaa    uaacgu 
Get sequence
Deep sequencing
3411 reads, 18.4 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr13: 22978470-22978539 [-]
intergenic
Database links

Mature sequence bta-miR-2285d

Accession MIMAT0011815
Sequence

46 - 

aaaccugaacgaaauuuuuggc

 - 67

Get sequence
Deep sequencing3410 reads, 38 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).