Stem-loop sequence bta-mir-2300b

AccessionMI0011311 (change log)
DescriptionBos taurus miR-2300b stem-loop
Gene family MIPF0000770; mir-2300
Literature search

1 open access papers mention bta-mir-2300b
(1 sentences)

Stem-loop
                         c       cuuaug 
5' ucuuauuccuuagcuaguuuug cucccug      a
   |||||||||||||||||||||| |||||||       
3' agaauaaggagucgaucaaaac gagggac      u
                         a       acacac 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 31918146-31918219 [+]
sense
ENSBTAT00000061117 ; FLT1-201; intron 18
antisense
ENSBTAT00000062316 ; bta-mir-2300a-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-2300b
bta-mir-2300achr12: 31918144-31918221 [-]
bta-mir-2300bchr12: 31918146-31918219 [+]
Database links

Mature sequence bta-miR-2300b-3p

Accession MIMAT0011810
Sequence

47 - 

gggagacaaaacuagcugagga

 - 68

Get sequence
Deep sequencing25 reads, 13 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).