Stem-loop sequence bta-mir-2299

AccessionMI0011309 (change log)
DescriptionBos taurus miR-2299 stem-loop
Literature search

2 open access papers mention bta-mir-2299
(6 sentences)

Stem-loop
          a   a               u  aagu     u 
5' uaacuga cac cuggauucauuucuc ga    ggauu u
   ||||||| ||| ||||||||||||||| ||    |||||  
3' guuggcu gug gaccuagguaagggg cu    ucugg g
          a   c               c  ---g     u 
Get sequence
Deep sequencing
1026 reads, 2.9 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 29753514-29753592 [-]
intergenic
Database links

Mature sequence bta-miR-2299-5p

Accession MIMAT0011807
Sequence

12 - 

acuggauucauuucucugaaa

 - 32

Get sequence
Deep sequencing965 reads, 67 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence bta-miR-2299-3p

Accession MIMAT0011808
Sequence

50 - 

uccggggaauggauccagcgu

 - 70

Get sequence
Deep sequencing61 reads, 29 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).