Stem-loop sequence bta-mir-2285a

AccessionMI0011299 (change log)
DescriptionBos taurus miR-2285a stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285a
(15 sentences)

Stem-loop
                g         a    cug    au 
5' gguuggccaagaa uucauuuag uuuu   uaca  g
   ||||||||||||| ||||||||| ||||   ||||   
3' cuaacugguucuu aaguaaguc aaaa   augu  u
                a         -    ---    au 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr1: 149503807-149503878 [-]
intergenic
Database links

Mature sequence bta-miR-2285a

Accession MIMAT0011797
Sequence

45 - 

aaaaacugaaugaaauucuugg

 - 66

Get sequence
Deep sequencing61 reads, 21 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).