Stem-loop sequence bna-MIR2111a

AccessionMI0011288 (change log)
DescriptionBrassica napus miR2111a stem-loop
Gene family MIPF0000754; MIR2111
Literature search

3 open access papers mention bna-MIR2111a
(3 sentences)

Stem-loop
   gaugacaa    u        cc                    -uuu      -ugauuau       ---ac    c 
5'         guau ggugagga  ggguaaucugcauccugagg    aaagcu        acgcaua     augc g
           |||| ||||||||  ||||||||||||||||||||    ||||||        |||||||     ||||  
3'         caua ucauuccu  uccauuaggcguagggcucc    uuucga        uguguau     uacg a
   -gcacaug    -        uc                    ugau      uaagauuu       caaua    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:AC189208: 23557-23707 [+]
intergenic
EM:AC189394: 23548-23698 [+]
intergenic
EM:DX056967: 176-326 [-]
intergenic
EM:ED537952: 191-341 [-]
intergenic
Database links

Mature sequence bna-miR2111a-5p

Accession MIMAT0011782
Previous IDsbna-miR2111a
Sequence

27 - 

uaaucugcauccugagguuua

 - 47

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bna-miR2111a-3p

Accession MIMAT0011783
Previous IDsbna-miR2111a*
Sequence

109 - 

guccucgggaugcggauuacc

 - 129

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19465578 "Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing" Pant BD, Musialak-Lange M, Nuc P, May P, Buhtz A, Kehr J, Walther D, Scheible WR Plant Physiol. 150:1541-1555(2009).
2