Stem-loop sequence bna-MIR2111b

AccessionMI0011287 (change log)
DescriptionBrassica napus miR2111b stem-loop
Gene family MIPF0000754; MIR2111
Literature search

3 open access papers mention bna-MIR2111b
(3 sentences)

Stem-loop
   gcacuugau      cu         c         u        --ac   g      g 
5'          gaggaa  gguaaucug auccugagg uuaaaaau    aua gcacau c
            ||||||  ||||||||| ||||||||| ||||||||    ||| ||||||  
3'          uuccuu  ccauuagac uagggcucc aauuuuug    uau ugugua a
   -aagucauu      cu         a         u        auau   g      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (BrassicaDB-20080411) Overlapping transcripts
EM:BH986382: 375-493 [+]
intergenic
Database links

Mature sequence bna-miR2111b-5p

Accession MIMAT0011780
Previous IDsbna-miR2111b
Sequence

20 - 

uaaucugcauccugagguuua

 - 40

Get sequence
Evidence by similarity; MI0010631

Mature sequence bna-miR2111b-3p

Accession MIMAT0011781
Previous IDsbna-miR2111b*
Sequence

83 - 

auccucgggauacagauuacc

 - 103

Get sequence
Evidence by similarity; MI0010631

References

1
PMID:19465578 "Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing" Pant BD, Musialak-Lange M, Nuc P, May P, Buhtz A, Kehr J, Walther D, Scheible WR Plant Physiol. 150:1541-1555(2009).