Stem-loop sequence hsa-mir-2278

Accession MI0011285
Description Homo sapiens miR-2278 stem-loop
Gene family MIPF0001522; mir-2278
Stem-loop 
   - u     ug      ag       u    c     ---g   -  g 
gug c gcagg  uuggag  cagugug guug cuggg    acu gu u
||| | |||||  ||||||  ||||||| |||| |||||    ||| ||  
uac g cgucc  gaccuc  gucacgu cgac gaccc    ugg ca g
   u c     ca      -a       u    a     acua   u  g
Get sequence
Deep sequencing
33 reads, 9 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 97572244-97572339 [+]
sense
OTTHUMT00000053201 ; C9orf3-006; intron 4
OTTHUMT00000053203 ; C9orf3-008; intron 4
OTTHUMT00000053201 ; C9orf3-006; intron 4
OTTHUMT00000053203 ; C9orf3-008; intron 4
OTTHUMT00000053201 ; C9orf3-006; intron 4
OTTHUMT00000053203 ; C9orf3-008; intron 4
OTTHUMT00000053197 ; C9orf3-002; intron 5
OTTHUMT00000053199 ; C9orf3-004; intron 5
OTTHUMT00000053197 ; C9orf3-002; intron 5
OTTHUMT00000053199 ; C9orf3-004; intron 5
OTTHUMT00000053197 ; C9orf3-002; intron 5
OTTHUMT00000053199 ; C9orf3-004; intron 5
ENST00000395357 ; C9orf3-204; intron 2
ENST00000395357 ; C9orf3-204; intron 2
ENST00000395357 ; C9orf3-202; intron 2
ENST00000424143 ; C9orf3-006; intron 4
ENST00000428313 ; C9orf3-008; intron 4
ENST00000375315 ; C9orf3-202; intron 4
ENST00000375316 ; C9orf3-203; intron 4
ENST00000424143 ; C9orf3-006; intron 4
ENST00000428313 ; C9orf3-008; intron 4
ENST00000375315 ; C9orf3-202; intron 4
ENST00000375316 ; C9orf3-203; intron 4
ENST00000424143 ; C9orf3-006; intron 4
ENST00000428313 ; C9orf3-008; intron 4
ENST00000375315 ; C9orf3-201; intron 4
ENST00000277198 ; C9orf3-004; intron 5
ENST00000297979 ; C9orf3-002; intron 5
ENST00000277198 ; C9orf3-004; intron 5
ENST00000297979 ; C9orf3-002; intron 5
ENST00000277198 ; C9orf3-004; intron 5
ENST00000297979 ; C9orf3-002; intron 5
Database links

Mature sequence hsa-miR-2278

Accession MIMAT0011778
Sequence

16 -  

gagagcaguguguguugccugg

 - 37

Get sequence
Deep sequencing 32 reads, 9 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).