Stem-loop sequence hsa-mir-2278

AccessionMI0011285 (change log)
Symbol HGNC:MIR2278
DescriptionHomo sapiens miR-2278 stem-loop
Gene family MIPF0001522; mir-2278
Literature search

2 open access papers mention hsa-mir-2278
(2 sentences)

Stem-loop
      - u     ug      ag       u    c     ---g   -  g 
5' gug c gcagg  uuggag  cagugug guug cuggg    acu gu u
   ||| | |||||  ||||||  ||||||| |||| |||||    ||| ||  
3' uac g cgucc  gaccuc  gucacgu cgac gaccc    ugg ca g
      u c     ca      -a       u    a     acua   u  g 
Get sequence
Deep sequencing
663 reads, 3.37 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 94809962-94810057 [+]
antisense
OTTHUMT00000055553 ; SPTLC1-001; exon 10
ENST00000262554 ; SPTLC1-001; exon 10
Database links

Mature sequence hsa-miR-2278

Accession MIMAT0011778
Sequence

16 - 

gagagcaguguguguugccugg

 - 37

Get sequence
Deep sequencing618 reads, 79 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).