Stem-loop sequence zma-MIR2275d

AccessionMI0011281 (change log)
DescriptionZea mays miR2275d stem-loop
Gene family MIPF0000797; MIR2275
Literature search

10 open access papers mention zma-MIR2275d
(15 sentences)

Stem-loop
   gucaggcacuaaaa      -            a    uaau    u    -ga  c    aug 
5'               gugaga guuggaggaaag aaac    cggc auca   uu ugca   g
                 |||||| |||||||||||| ||||    |||| ||||   || ||||   c
3'               cacucu uaaucuccuuuu uuug    gccg uagu   aa acgu   u
   ---------acuuc      a            g    ccuu    u    aca  u    agu 
Get sequence
Deep sequencing
140 reads, 983 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 207980073-207980192 [+]
intergenic
Database links

Mature sequence zma-miR2275d-5p

Accession MIMAT0011773
Sequence

18 - 

agaguuggaggaaagaaaacu

 - 38

Get sequence
Deep sequencing34 reads, 8 experiments
Evidence by similarity; MI0011278

Mature sequence zma-miR2275d-3p

Accession MIMAT0011774
Sequence

93 - 

uuuguuuuccucuaauaucuca

 - 114

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0011278

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).