Stem-loop sequence zma-MIR2275c

AccessionMI0011280 (change log)
DescriptionZea mays miR2275c stem-loop
Literature search

10 open access papers mention zma-MIR2275c
(15 sentences)

Stem-loop
     a      uugau   u         ag     -          c       auucauagcuuguucgguuaugucuggaucgaagaggguuggaagguccuuucuaguuaaaauuaaau 
5' ag gagaug     aug gucauuuga  ugagg auuagaggga uugaacc                                                                    a
   || ||||||     ||| |||||||||  ||||| |||||||||| |||||||                                                                     
3' uc cucuac     uac cgguaaauu  acucu uaaucuccuu gacuugg                                                                    g
     -      -----   c         cu     a          u       ggaaaaugaggguuacucucaaacaaaccaguguagaccuauccuccaauuucccuaaguuagagaaa 
Get sequence
Deep sequencing
800 reads, 877 reads per million, 167 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 70573557-70573793 [+]
intergenic
Database links

Mature sequence zma-miR2275c-5p

Accession MIMAT0011771
Sequence

32 - 

aggauuagagggacuugaacc

 - 52

Get sequence
Deep sequencing581 reads, 160 experiments
Evidence by similarity; MI0011278

Mature sequence zma-miR2275c-3p

Accession MIMAT0011772
Sequence

193 - 

uucaguuuccucuaauaucuca

 - 214

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).