Stem-loop sequence zma-MIR2275b

AccessionMI0011279 (change log)
DescriptionZea mays miR2275b stem-loop
Gene family MIPF0000797; MIR2275
Literature search

10 open access papers mention zma-MIR2275b
(15 sentences)

Stem-loop
       c   ag     -        c         --au  u 
5' ccau uga  ugagg auuagagg aacugaacc    ca c
   |||| |||  ||||| |||||||| |||||||||    || u
3' ggua gcu  acucu uaaucucc uugacuugg    gu a
       a   cu     a        u         aaac  u 
Get sequence
Deep sequencing
178 reads, 197 reads per million, 118 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature product from the 5' arm of the hairpin dominates over the 3' arm, but the conservation signature with rice suggests that the 3' arm may be functional [1].

Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 31734063-31734144 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR2275b
zma-MIR2275achr4: 31733907-31734028 [+]
zma-MIR2275bchr4: 31734063-31734144 [+]
Database links

Mature sequence zma-miR2275b-5p

Accession MIMAT0011769
Sequence

13 - 

aggauuagaggcaacugaacc

 - 33

Get sequence
Deep sequencing155 reads, 119 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence zma-miR2275b-3p

Accession MIMAT0011770
Sequence

51 - 

uucaguuuccucuaauaucuca

 - 72

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).