Stem-loop sequence zma-MIR2275a

AccessionMI0011278 (change log)
DescriptionZea mays miR2275a stem-loop
Gene family MIPF0000797; MIR2275
Literature search

10 open access papers mention zma-MIR2275a
(15 sentences)

Stem-loop
          -----      a      -                        --     gga   ag 
5' gucaggc     acugaa gugaga guuggaggaaagcaaaccggcugg  guauc   uuc  c
   |||||||     |||||| |||||| ||||||||||||||||||||||||  |||||   |||   
3' uagucug     ugacuu cacucu uaaccuccuuuuguuuggcuggcc  cgugg   agg  a
          auagc      c      a                        gu     --g   ca 
Get sequence
Deep sequencing
814 reads, 811 reads per million, 164 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature product from the 5' arm of the hairpin dominates over the 3' arm, but the conservation signature with rice suggests that the 3' arm may be functional [1].

Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 31733907-31734028 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR2275a
zma-MIR2275achr4: 31733907-31734028 [+]
zma-MIR2275bchr4: 31734063-31734144 [+]
Database links

Mature sequence zma-miR2275a-5p

Accession MIMAT0011767
Sequence

18 - 

agaguuggaggaaagcaaacc

 - 38

Get sequence
Deep sequencing24 reads, 7 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence zma-miR2275a-3p

Accession MIMAT0011768
Sequence

81 - 

uuuguuuuccuccaauaucuca

 - 102

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).