Stem-loop sequence zma-MIR2118g

AccessionMI0011277 (change log)
DescriptionZea mays miR2118g stem-loop
Gene family MIPF0000745; MIR2118
Literature search

11 open access papers mention zma-MIR2118g
(13 sentences)

Stem-loop
       ---     a   ugaa   uu        ac           -a   ga            uu u  a   a 
5' gcca   ggaaa gga    aga  cuaagagc  uaggaauagga  cau  aggaaagcauua  g gc ugg g
   ||||   ||||| |||    |||  ||||||||  |||||||||||  |||  ||||||||||||  | || |||  
3' cggu   ccuuu ccu    ucu  gauucucg  auccuuauccu  gua  uccuuuuguagu  c cg auu a
       auu     c   -ucc   ug        ga           cc   -g            -- -  g   u 
Get sequence
Deep sequencing
177 reads, 244 reads per million, 121 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 51409047-51409191 [+]
intergenic
Database links

Mature sequence zma-miR2118g

Accession MIMAT0011766
Sequence

90 - 

uuccugaugccuccuauuccua

 - 111

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).