Stem-loop sequence zma-MIR2118f

AccessionMI0011276 (change log)
DescriptionZea mays miR2118f stem-loop
Gene family MIPF0000745; MIR2118
Literature search

11 open access papers mention zma-MIR2118f
(13 sentences)

Stem-loop
                       -a   a      a  c     ---------          guac 
5' uaagagcagugggcauggga  cau ggggaa gc aaacu         uucuuuaccu    a
   ||||||||||||||||||||  ||| |||||| || |||||         ||||||||||     
3' auucuuguuauccguaccuu  gua cccuuu ug uuuga         aagagguggg    a
                       cc   a      g  a     uuagagguc          aauc 
Get sequence
Deep sequencing
405 reads, 438 reads per million, 135 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 118740280-118740399 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR2118f
zma-MIR2118echr10: 118740501-118740643 [-]
zma-MIR2118fchr10: 118740280-118740399 [-]
Database links

Mature sequence zma-miR2118f

Accession MIMAT0011765
Sequence

90 - 

uucccaaugccuuccaugccua

 - 111

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).