Stem-loop sequence zma-MIR2118e

AccessionMI0011275 (change log)
DescriptionZea mays miR2118e stem-loop
Gene family MIPF0000745; MIR2118
Literature search

11 open access papers mention zma-MIR2118e
(13 sentences)

Stem-loop
       -     u     aaa   aa gu        a          -aa    ga          ----------      
5' ccaa ggaag ggaag   gag  u  cuaagagc gugggaaugg   acau  aggaaagcau          gaacu 
   |||| ||||| |||||   |||  |  |||||||| ||||||||||   ||||  ||||||||||          |||| a
3' gguu ccuuc ccuuc   cuc  g  gauucuug cauccuuacc   ugua  uccuuuugua          cuugu 
       u     u     ---   -- ug        g          cuc    -g          agucuuuuuu      
Get sequence
Deep sequencing
666 reads, 687 reads per million, 137 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 118740501-118740643 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR2118e
zma-MIR2118echr10: 118740501-118740643 [-]
zma-MIR2118fchr10: 118740280-118740399 [-]
Database links

Mature sequence zma-miR2118e

Accession MIMAT0011764
Sequence

90 - 

uuccugaugucucccauuccua

 - 111

Get sequence
Deep sequencing21 reads, 6 experiments
Evidence not experimental

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).