Stem-loop sequence zma-MIR2118d

AccessionMI0011274 (change log)
DescriptionZea mays miR2118d stem-loop
Gene family MIPF0000745; MIR2118
Literature search

12 open access papers mention zma-MIR2118d
(14 sentences)

Stem-loop
         ---au g         a   g      g   a            aca  -g          ---      g 
5' gugagc     g aagaggaag gag gucuaa agc gugggcauggga   cg  aggaaggccu   augagu g
   ||||||     | ||||||||| ||| |||||| ||| ||||||||||||   ||  ||||||||||   |||||| a
3' cacucg     c uucuccuuc cuc uggauu uug uauccguacccu   gu  uccuucuggg   uacucg a
         guuuu g         -   g      g   c            -cc  ag          uuu      a 
Get sequence
Deep sequencing
232 reads, 268 reads per million, 139 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 51343097-51343244 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR2118d
zma-MIR2118bchr2: 51342905-51343022 [+]
zma-MIR2118dchr2: 51343097-51343244 [+]
Database links

Mature sequence zma-miR2118d

Accession MIMAT0011763
Sequence

89 - 

uuccugaugccucccaugccua

 - 110

Get sequence
Deep sequencing37 reads, 13 experiments
Evidence not experimental

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).