Stem-loop sequence zma-MIR2118c

AccessionMI0011273 (change log)
DescriptionZea mays miR2118c stem-loop
Gene family MIPF0000745; MIR2118
Literature search

11 open access papers mention zma-MIR2118c
(13 sentences)

Stem-loop
    g         uaaa   g          a     c      -a   gg        - --u       u 
5' g aagaggaag    gau aucuaagagc guggg auggga  cau  aggaaggc c   augaggu g
   | |||||||||    ||| |||||||||| ||||| ||||||  |||  |||||||| |   |||||||  
3' c uucuccuuc    cua uggauucuug uaucc uacccu  gua  uccuucug g   uacucca a
    g         ----   g          c     u      cc   -a        u uuu       a 
Get sequence
Deep sequencing
98 reads, 610 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 118813614-118813746 [-]
intergenic
Database links

Mature sequence zma-miR2118c

Accession MIMAT0011762
Sequence

85 - 

uuccuaaugccucccauuccua

 - 106

Get sequence
Deep sequencing11 reads, 6 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).