Stem-loop sequence zma-MIR2118b

AccessionMI0011272 (change log)
DescriptionZea mays miR2118b stem-loop
Gene family MIPF0000745; MIR2118
Literature search

12 open access papers mention zma-MIR2118b
(15 sentences)

Stem-loop
                       -a   g a     -   cau  uguu       u    cag 
5' uaagagcagugggaauggga  cau g ggaaa gcc   cc    gguuucc ccuc   a
   ||||||||||||||||||||  ||| | ||||| |||   ||    ||||||| ||||    
3' auucuuguuauccuuacccu  gua c ccuuu ugg   gg    ucgaagg ggag   a
                       cc   g -     g   cuu  ---u       u    cca 
Get sequence
Deep sequencing
85 reads, 613 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 51342905-51343022 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR2118b
zma-MIR2118bchr2: 51342905-51343022 [+]
zma-MIR2118dchr2: 51343097-51343244 [+]
Database links

Mature sequence zma-miR2118b

Accession MIMAT0011761
Sequence

88 - 

uucccgaugccucccauuccua

 - 109

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).