Stem-loop sequence zma-MIR2118a

AccessionMI0011271 (change log)
DescriptionZea mays miR2118a stem-loop
Gene family MIPF0000745; MIR2118
Literature search

11 open access papers mention zma-MIR2118a
(13 sentences)

Stem-loop
            a            -a   ga          --    u ugaa    u   c 
5' ccuaagggc guagggaugaga  cau  aggaacgcga  gugc c    uuuc cgu u
   ||||||||| ||||||||||||  |||  ||||||||||  |||| |    |||| ||| c
3' ggauucuug uauccuuacucu  gua  uccuugugcu  cacg g    ggag gca g
            g            cc   -g          gu    u uaca    -   c 
Get sequence
Deep sequencing
852 reads, 801 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 118790595-118790712 [-]
intergenic
Database links

Mature sequence zma-miR2118a

Accession MIMAT0011760
Sequence

86 - 

uuccugaugccucucauuccua

 - 107

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).