Stem-loop sequence osa-MIR2275b

AccessionMI0011270 (change log)
DescriptionOryza sativa miR2275b stem-loop
Gene family MIPF0000797; MIR2275
Literature search

14 open access papers mention osa-MIR2275b
(70 sentences)

Stem-loop
   u           u      -     u gg          -------a    ag 
5'  ggcagcugaau ugaggu uugga g  accaaaucuu        cugc  a
    ||||||||||| |||||| ||||| |  ||||||||||        ||||   
3'  cuguugacuug acucua aaccu c  ugguuuagaa        gacg  c
   a           u      u     c uu          cagaacga    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 1202490-1202589 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2275b
osa-MIR2275bChr8: 1202490-1202589 [+]
osa-MIR2275aChr8: 1204975-1205135 [+]
Database links

Mature sequence osa-miR2275b

Accession MIMAT0011759
Sequence

66 - 

uuugguuuccuccaauaucuca

 - 87

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).