Stem-loop sequence osa-MIR2275a

AccessionMI0011269 (change log)
DescriptionOryza sativa miR2275a stem-loop
Gene family MIPF0000797; MIR2275
Literature search

14 open access papers mention osa-MIR2275a
(70 sentences)

Stem-loop
         g   --g      caaac   aauc       gu     u      -     u gg          -------a    ag 
5' agcuua cua   gcauca     cau    uuuggca  ugaau ugaggu uugga g  accaaaucuu        cugc  a
   |||||| |||   ||||||     |||    |||||||  ||||| |||||| ||||| |  ||||||||||        ||||   
3' ucgagu gau   cguggu     gug    agacugu  acuug acucua aaccu c  ugguuuagaa        gacg  c
         -   uaa      aauaa   --ac       ug     u      u     c uu          cgcaauua    uu 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 1204975-1205135 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2275a
osa-MIR2275bChr8: 1202490-1202589 [+]
osa-MIR2275aChr8: 1204975-1205135 [+]
Database links

Mature sequence osa-miR2275a

Accession MIMAT0011758
Sequence

97 - 

uuugguuuccuccaauaucuca

 - 118

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).