Stem-loop sequence osa-MIR2118r

AccessionMI0011268 (change log)
DescriptionOryza sativa miR2118r stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118r
(162 sentences)

Stem-loop
    ug    ---      a     aaaa   gg         a            -a   --       gaacau   cu    uuc      a 
5' g  aguc   gggaag ggaag    gag  ucuaagagc gugggcauggga  cau  ggaggaa      gua  uuuc   ccucua a
   |  ||||   |||||| |||||    |||  ||||||||| ||||||||||||  |||  |||||||      |||  ||||   ||||||  
3' c  ucgg   uccuuc ccuuc    cuc  ggauucuug cauccguacccu  gua  ccuuuuu      cgu  agag   ggagau u
    gu    uug      c     ----   au         a            cc   ac       acgaau   uu    -uu      u 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 7810223-7810397 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118r
osa-MIR2118qChr11: 7810709-7810885 [-]
osa-MIR2118rChr11: 7810223-7810397 [-]
osa-MIR2118pChr11: 7807433-7807606 [-]
Database links

Mature sequence osa-miR2118r

Accession MIMAT0011757
Sequence

116 - 

uucccaaugccucccaugccua

 - 137

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).