Stem-loop sequence osa-MIR2118p

AccessionMI0011266 (change log)
DescriptionOryza sativa miR2118p stem-loop
Gene family MIPF0000745; MIR2118
Literature search

28 open access papers mention osa-MIR2118p
(163 sentences)

Stem-loop
      g    ---           aaaa           ag              -a   g a     -gu     - ucu  uu          
5' gug guca   ggaagaggaag    gaguaccuaag  uagugggcauggga  cau g ggaaa   ucaaa c   uc  ccccucuaa 
   ||| ||||   |||||||||||    |||||||||||  ||||||||||||||  ||| | |||||   ||||| |   ||  |||||||| a
3' cac cggu   ccuucuccuuc    cucguggauuc  guuauccguacccu  gua c ccuuu   aguuu g   ag  ggggggauu 
      a    uuc           ----           cu              cc   g -     ugu     u uuc  cu          
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 7807433-7807606 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118p
osa-MIR2118qChr11: 7810709-7810885 [-]
osa-MIR2118rChr11: 7810223-7810397 [-]
osa-MIR2118pChr11: 7807433-7807606 [-]
Database links

Mature sequence osa-miR2118p

Accession MIMAT0011755
Sequence

115 - 

uucccgaugccucccaugccua

 - 136

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).